Intestinal Cobalamin Malabsorption (Giant Schnauzer Type)

Other Names: Amnionless Deficiency, Cobalamin Deficiency, Imerslund-Grasbeck Syndrome, Vitamin B12 Deficiency, I-GS
Affected Genes: AMN
Inheritance: Autosomal Recessive
Mutation: chr8:70807271-70807303: 33 bp deletion (del CGGGCTGCTGCTGCTGCTGCTGGCGCTGGCGGC)

Add To Cart Search Tests

Common Symptoms

Intestinal cobalamin malabsorption (giant schnauzer type) is an inherited disease affecting dogs. Affected dogs are unable to make adequate amounts of a protein that plays a role in absorption of certain nutrients from the intestinal tract and kidneys, including the B vitamin, cobalamin. Symptoms begin as early as 6 to 12 weeks of age and include anorexia, lethargy, poor weight gain, and poor muscle mass. In rare circumstances, a severe neurological dysfunction called hepatic encephalopathy may develop leading to an altered mental state, seizures, coma and death. From a young age affected dogs have increased levels of methylmalonic acid, and an increase in certain proteins in their urine (a sign of cobalamin deficiency). Decreased production of blood cells in affected dogs results in Anemia and decreased numbers of neutrophils, a type of white blood cell. Affected dogs require cobalamin supplementation for life. Most animals respond to treatment within a few weeks. Though not associated with clinical disease, affected dogs will continue to pass increased amounts of certain proteins in their urine even with cobalamin supplementation.


Breed-Specific Information for the Giant Schnauzer

The Mutation of the AMN gene associated with intestinal cobalamin malabsorption (giant schnauzer type) has been identified in giant schnauzers, although its overall frequency in this breed is unknown.


Testing Tips

Genetic testing of the AMN in giant schnauzers will reliably determine whether a dog is a genetic Carrier of intestinal cobalamin malabsorption (giant schnauzer type). Intestinal cobalamin malabsorption (giant schnauzer type) is inherited in an Autosomal Recessive manner in dogs meaning that they must receive two copies of the mutated gene (one from each parent) to develop the disease. In general, carrier dogs do not have features of the disease but when bred with another carrier of the same Mutation, there is a risk of having affected pups. Each pup that is born to this pairing has a 25% chance of inheriting the disease and a 50% chance of inheriting one copy and being a carrier of the AMN gene mutation. Reliable genetic testing is important for determining breeding practices. In order to eliminate this mutation from breeding lines and to avoid the potential of producing affected pups, breeding of known carriers to each other is not recommended. Giant schnauzers that are not carriers of the mutation have no increased risk of having affected pups.


There may be other causes of this condition in dogs and a normal result does not exclude a different mutation in this gene or any other gene that may result in a similar genetic disease or trait.


References

  • Fyfe JC, Jezyk PF, Giger U, Patterson DF. Inherited Selective Malabsorption of Vitamin B12 in Giant Schnauzers. J Am Anim Hosp Assoc. 1989;25:533–539. [Not in PubMed]
  • He Q, Madsen M, Kilkenney A, Gregory B, Christensen EI, Vorum H, Hojrup P, Schaffer AA, Kirkness EF, Tanner SM, de la Chapelle A, Giger U, Moestrup SK, Fyfe JC. Amnionless function is required for cubilin brush-border expression and intrinsic factor-cobalamin (vitamin B12) absorption in vivo. Blood. 2005 Aug 15;106(4):1447-53. [PubMed: 15845892]